Skip to main content

Table 1 Primers and conditions for the RT-PCR experiments performed in this study.

From: Effect of splenectomy on type-1/type-2 cytokine gene expression in a patient with adult idiopathic thrombocytopenic purpura (ITP)

Gene Sequence (5'→3') T (°C) Product (bp)
IL-2 GCAACTCCTGTCTTGCATTG
AATGTGAGCATCCTGGTGAG
59 173
IFN-γ AGCTCTGCATCGTTTTGGGTTC
CAAATATTGCAGGCAGGACAACC
64 492
IL-4 CTGTGCTCCGGCAGTTCTAC
ACGTACTCTGGTTGGCTTCC
58 176
IL-5 GCTTCTGCATTTGAGTTTGCTAGCT
TGGCCGTCAATGTATTTCTTTATTAAG
59 291
IL-10 ACCCAGTCTGAGAACAGCTGC
GTTCACATGCGCCTTGATGTCT
61 260
β2m CCCCCACTGAAAAAGATGAG
TCACTCAATCCAAATGCGGC
56 150